COVİD-19 RNA'sı ve IGM tayinine yönelik biyosensör sistemleri geliştirilmesi
dc.contributor.advisor | Akçay, Yasemin | |
dc.contributor.author | Akkurt, Sinan Şaban | |
dc.date.accessioned | 2024-08-19T19:54:32Z | |
dc.date.available | 2024-08-19T19:54:32Z | |
dc.date.issued | 2022 | |
dc.department | Ege Üniversitesi, Sağlık Bilimleri Enstitüsü, Tıbbi Biyokimya Ana Bilim Dalı | en_US |
dc.description | en_US | |
dc.description.abstract | COVID-19 çok ciddi bir solunum yolu hastalığıdır. Tanı konması ise alınan örnek içerisindeki genomunun analizini gerçekleştiren Polimeraz Zincir Reaksiyonu (PCR) ile mümkündür. Bu analiz ise yaklaşık 4 saat sürmektedir. Bu nedenle gerçekleştirdiğimiz çalışmada PCR reaksiyonu yerine sadece COVID-19 hedef virüsünde bulunan RNA'nın tayini için kapasitif temelli bir biyosensör geliştirilmiştir. pM dizeyinde ve duyarlı bir analiz gerçekleştirebilmeyi başarmakla birlikte, biyosensör performans testleri de gerçekleştirilmiştir. Bu genosensörde biyotanıma ajanı olarak COVID-19 prob RNA'sı kullanılmıştır. COVID-19 RNA primeri ise https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome programı ile online olarak benzerlik taraması yapılarak belirlenmiştir. Bu çalışma ile prob RNA dizisi olarak 5'CAGAUUCAACUGGCAGUAACCAGA'3 olarak komplmenteri belirlenmiştir. Bunun yanonda ikincil bir biyobelirteç olan IgM ölçümü de COVID-19 belirtilerini doğrulamak için çalışılmıştır ve biyotanıma ajanı olarak anti-IgM kullanılarak iki farklı biyosensör geliştirilmiştir. Ölçümlerde kapasitans (C) kullanılmıştır kullanılacaktır. Kapasitif ölçümler tek moleküle kadar duyarlı ölçümler sağlayabilmeleri sayesinde duyarlılık için tercih edilmiştir. Bu şekilde ülkemize katma değer sağlayabilecek bir ürünün ilk aşamaları geliştirilerek konsept bir virüs biyosensör sistemi geliştirilmiştir | en_US |
dc.description.abstract | COVID-19 is a very serious respiratory disease. Diagnosis is possible with Polymerase Chain Reaction (PCR), which analyzes the genome in the sample. This analysis takes about 4 hours. Therefore, in our study, a capacitive-based biosensor was developed for the determination of RNA only in the COVID-19 target virus, instead of the PCR reaction. Biosensor performance tests were also carried out, although we were able to perform a sensitive analysis in the pM array. COVID-19 probe RNA was used as a biorecognition agent in this genosensor. The COVID-19 RNA primer was determined by online similarity scanning with the https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome program. In this study, the complement of 5'CAGAUUCAACUGGCAGUAACCAGA'3 was determined as the probe RNA sequence. Besides, measurement of IgM, a secondary biomarker, has also been studied to confirm the symptoms of COVID-19, and two different biosensors have been developed using anti-IgM as a biorecognition agent. Capacitance (C) will be used in the measurements. Capacitive measurements have been preferred for sensitivity as they can provide sensitive measurements up to a single molecule. In this way, a concept virus biosensor system was developed by developing the first stages of a product that can add value to our country.. | en_US |
dc.identifier.endpage | 71 | en_US |
dc.identifier.startpage | 1 | en_US |
dc.identifier.uri | https://hdl.handle.net/11454/89225 | |
dc.identifier.yoktezid | 765682 | en_US |
dc.language.iso | tr | en_US |
dc.publisher | Ege Üniversitesi | en_US |
dc.relation.publicationcategory | Tez | en_US |
dc.rights | info:eu-repo/semantics/openAccess | en_US |
dc.subject | Allerji ve İmmünoloji | en_US |
dc.subject | Allergy and Immunology | en_US |
dc.subject | Biyokimya | en_US |
dc.subject | Biochemistry | en_US |
dc.subject | Mikrobiyoloji | en_US |
dc.subject | Microbiology | en_US |
dc.title | COVİD-19 RNA'sı ve IGM tayinine yönelik biyosensör sistemleri geliştirilmesi | en_US |
dc.title.alternative | Development of biosensor systems for COVİD-19 RNA and İGM detection | en_US |
dc.type | Doctoral Thesis | en_US |
Dosyalar
Orijinal paket
1 - 1 / 1